this post was submitted on 23 Jul 2023
404 points (94.7% liked)

Memes

46037 readers
1654 users here now

Rules:

  1. Be civil and nice.
  2. Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 5 years ago
MODERATORS
 

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

top 11 comments
sorted by: hot top controversial new old
[–] [email protected] 18 points 1 year ago (1 children)

Ugh it didn't blast or translate

EMBOSS_001_1
NVIALPVGTX
EMBOSS_001_2
TS
PDYQVLX
EMBOSS_001_3
RHSLITSRY

EMBOSS_001_4
STYW*SGYDV
EMBOSS_001_5
YLLVIRLRX
EMBOSS_001_6
LVPTGNQAMTX

[–] [email protected] 2 points 1 year ago (1 children)

Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?

[–] [email protected] 10 points 1 year ago

If "reading" the sequence, it sounds similar to Mr Krab's laugh

[–] [email protected] 5 points 1 year ago

Only 3 billion short

[–] [email protected] 5 points 1 year ago (2 children)

I wonder if theoretically you could share humans through the internet? Share your sequence and someone can download it and build it with a theoretical machine. Would probably be a few Petabytes of data though like you can see in that Black Mirror episode with that spaceship.

[–] Mininux 10 points 1 year ago (3 children)

If we ignore the mutations in the life of an individual, it would actually only be a few hundreds megabytes. Or if we already have a template of a human genome and we only code the difference between them and the human we want to copy, a few megabytes is enough since we all share A LOT of sequences

Wikipedia: Human genome#Information content

[–] [email protected] 4 points 1 year ago

ya I've kind of been wondering if with how foods and random mutations affect dna I doubt you could use baby you dna to get an adult that actually looks exactly like you

[–] [email protected] 2 points 1 year ago (1 children)

There is also epigenetic modifications to be considered

[–] Mininux 1 points 1 year ago

Oh cool I didn't know that stuff, it's super interesting

[–] [email protected] 0 points 1 year ago

It bottles the mind.

[–] [email protected] 5 points 1 year ago

The future of onlyfans products