Memes

46037 readers

1603 users here now

Rules:

Be civil and nice.
Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 5 years ago

MODERATORS

[email protected]

404

AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)

submitted 1 year ago by [email protected] to c/[email protected]

11 comments fedilink hide all child comments

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

you are viewing a single comment's thread
view the rest of the comments

[–] [email protected] 2 points 1 year ago (1 children)

Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?

[–] [email protected] 10 points 1 year ago

If "reading" the sequence, it sounds similar to Mr Krab's laugh